0 Daumen
88 Aufrufe

Aufgaben:

1.) Welche Zellbestandteile fehlen tierischen Zellen im Gegensatz zu Pflanzenzellen?

2.) Definiere Diffusion und Osmose.

3.) Welche Membranbestandteile sind fĂŒr einen aktiven Stofftransport durch eine Biomembran verantwortlich?

4.) Definiere den Begriff Endo- und Exozytose.

5.) Eine Pflanzenzelle wird in destilliertes Wasser gelegt. Beschreibe die anschließend ablaufenden VorgĂ€nge.

6.) Wo befinden sich unsere Erbanlagen und auf welchen Strukturen ist diese genetische Information gespeichert?

7.) Welches Ziel verfolgt der Vorgang der Replikation?

8.) Verdeutliche den Unterschied zwischen Mitose und Meiose durch AusfĂŒllen der folgenden Tabelle:

MitoseMeiose
Anzahl Teilungen
Anzahl der Zellen und ihr Chromosomensatz (n) am Ende des Vorgangs
Was wird wÀhrend der Anaphase zu den Polen gezogen?

9.) Nenne drei mögliche Mutationsarten und fĂŒge jeweils ein Beispiel. fĂŒr eine dadurch hervorgerufene Erkrankung an.

10.) Innerhalb eines Gens hat eine Mutation stattgefunden. Vergleiche den dargestellten Genzustand vor und nach der Mutation:
3' GUAAGUAAGUACGUAAGUAAGUAA 5'
3. GUAAGUAAGUAAGUAAGUAAGUAA 5'
ursprĂŒngliche DNA mutierte DNA.

Um welchen Mutationstyp handelt es sich und welche konkrete Auswirkung ist hinsichtlich des Ablaufs der Proteinbiosynthese zu erwarten? Ziehe hierzu die Codesonne (https://de.wikipedia.org/wiki/CodeSonne\#/media/Datei:Aminoacids_table.svg) hinzu.

11.) Die Proteinbiosynthese kann gut mit der Planung und Fertigstellung eines Hauses verglichen werden. Versuche folgenden Begriffen die entsprechenden Strukturen und VorgĂ€nge in der Zelle zuzuordnen: PlanungsbĂŒro, Bauplan fĂŒr ein bestimmtes Haus, Kopie des Plans, Baustelle, Spezialfahrzeuge, Baumaterialien, Bauarbeiter, fertiges Haus.

Avatar von

1 Antwort

0 Daumen

Antwort mit KI erzeugt

1.) Welche Zellbestandteile fehlen tierischen Zellen im Gegensatz zu Pflanzenzellen?

Tierischen Zellen fehlen im Vergleich zu Pflanzenzellen typischerweise folgende Strukturen:
- Zellwand: Pflanzenzellen besitzen eine Zellwand aus Cellulose, die den Zellen Struktur gibt und sie vor Ă€ußeren EinflĂŒssen schĂŒtzt.
- Chloroplasten: Diese fĂŒr die Photosynthese notwendigen Organellen sind in tierischen Zellen nicht vorhanden. Photosynthese ist der Prozess, durch den Pflanzen Sonnenlicht nutzen, um aus Kohlendioxid und Wasser Zucker und Sauerstoff zu produzieren.
- Vakuolen: WĂ€hrend beide Zelltypen Vakuolen enthalten können, sind die großen zentralen Vakuolen, die fĂŒr die Speicherung von NĂ€hrstoffen und die Aufrechterhaltung des Zellturgors verantwortlich sind, charakteristisch fĂŒr Pflanzenzellen.

2.) Definiere Diffusion und Osmose.

- Diffusion ist ein Prozess, bei dem Teilchen von einem Bereich höherer Konzentration zu einem Bereich niedrigerer Konzentration wandern, bis ein Gleichgewicht erreicht ist. Dieses natĂŒrliche PhĂ€nomen tritt aufgrund der kinetischen Energie der Teilchen auf und benötigt keine Energiezufuhr.
- Osmose ist die spezifische Diffusion von Wasser durch eine semipermeable Membran von einer Lösung niedrigerer Konzentration zu einer Lösung höherer Konzentration. Dieser Vorgang zielt darauf ab, die Konzentrationen auf beiden Seiten der Membran auszugleichen.

3.) Welche Membranbestandteile sind fĂŒr einen aktiven Stofftransport durch eine Biomembran verantwortlich?

FĂŒr den aktiven Stofftransport durch eine Biomembran sind hauptsĂ€chlich Proteine verantwortlich, insbesondere Pumpen und Carrier-Proteine. Diese benötigen Energie in Form von ATP (Adenosintriphosphat), um MolekĂŒle gegen ihren Konzentrationsgradienten zu transportieren.

4.) Definiere den Begriff Endo- und Exozytose.

- Endozytose ist ein Vorgang, bei dem Zellen Material von außerhalb der Zelle aufnehmen, indem sie um das Material eine Membran bilden und es in Vesikeln einschließen.
- Exozytose ist der umgekehrte Prozess, bei dem Inhalte von Vesikeln innerhalb der Zelle nach außen transportiert werden, indem die Vesikelmembran mit der Zellmembran fusioniert und die Inhalte freigesetzt werden.

5.) Eine Pflanzenzelle wird in destilliertes Wasser gelegt. Beschreibe die anschließend ablaufenden VorgĂ€nge.

Wenn eine Pflanzenzelle in destilliertes Wasser gelegt wird, fließt Wasser durch Osmose in die Zelle, da die Wasserpotentialdifferenz dazu fĂŒhrt, dass Wasser von einem Bereich niedrigerer Lösungskonzentration (destilliertes Wasser) in den Bereich höherer Lösungskonzentration (Zellinneres) wandert. Die Zelle schwillt an, aber die Zellwand verhindert ihr Platzen. Dies fĂŒhrt zur Turgorspannung, die der Pflanzenzelle Steifheit und Festigkeit verleiht.

6.) Wo befinden sich unsere Erbanlagen und auf welchen Strukturen ist diese genetische Information gespeichert?

Unsere Erbanlagen befinden sich in den Zellkernen aller Körperzellen in Form von DNA (DesoxyribonukleinsÀure). Diese genetische Information ist auf Chromosomen gespeichert, die kapellenartige Strukturen darstellen, in denen die DNA eng um Histone (Proteine) gewickelt ist.

7.) Welches Ziel verfolgt der Vorgang der Replikation?

Das Ziel der Replikation ist es, die DNA in einer Zelle zu verdoppeln, um sicherzustellen, dass jede Tochterzelle bei der Zellteilung eine exakte Kopie des genetischen Materials erhĂ€lt. Dies ist entscheidend fĂŒr das Wachstum, die Reparatur und die Reproduktion von Organismen.

8.) Verdeutliche den Unterschied zwischen Mitose und Meiose durch AusfĂŒllen der folgenden Tabelle:

| | Mitose | Meiose |
|---|---|---|
| Anzahl Teilungen | 1 | 2 |
| Anzahl der Zellen und ihr Chromosomensatz (n) am Ende des Vorgangs | 2 Zellen, diploid (2n) | 4 Zellen, haploid (n) |
| Was wird wÀhrend der Anaphase zu den Polen gezogen? | Schwesterchromatiden | In der Meiose I: homologe Chromosomen, In der Meiose II: Schwesterchromatiden |

9.) Nenne drei mögliche Mutationsarten und fĂŒge jeweils ein Beispiel fĂŒr eine dadurch hervorgerufene Erkrankung an.
- Punktmutation (Substitution): Ersetzen eines einzelnen Nukleotids durch ein anderes. Beispiel: Sichelzellkrankheit.
- Deletion: Verlust eines oder mehrerer Nukleotide im DNA-MolekĂŒl. Beispiel: Cystische Fibrose (wenn durch eine Deletion verursacht).
- Insertion: EinfĂŒgen eines oder mehrerer Nukleotide in das DNA-MolekĂŒl. Beispiel: Huntington-Krankheit.

10.) Vergleiche den dargestellten Genzustand vor und nach der Mutation:

Die Mutation zeigt eine Deletion eines Nukleotids, da in der mutierten DNA-Sequenz ein "G" weniger vorhanden ist. Dieser Typ wird als Deletionsmutation bezeichnet. Eine solche Mutation kann zu einem Verschiebungsrahmen fĂŒhren, bei dem die gesamte nachfolgende Sequenz ab dem Punkt der Deletion falsch abgelesen wird. Die Auswirkungen auf die Proteinbiosynthese könnten erheblich sein, da ab dem Punkt der Mutation andere AminosĂ€uren in das Protein eingebaut werden könnten, was potenziell zu einem funktionsuntĂŒchtigen Protein fĂŒhrt.

11.) Die Proteinbiosynthese und der Hausbau:

- PlanungsbĂŒro: Zellkern (hier wird die DNA gespeichert).
- Bauplan fĂŒr ein bestimmtes Haus: Ein spezifisches Gen auf der DNA.
- Kopie des Plans: mRNA (Messenger RNA), die durch Transkription des Gens entsteht.
- Baustelle: Ribosom (Ort der Proteinbiosynthese).
- Spezialfahrzeuge: tRNA (Transfer RNA), die AminosÀuren zum Ribosom transportiert.
- Baumaterialien: AminosÀuren.
- Bauarbeiter: Enzyme und das Ribosom, die zusammen das Protein herstellen.
- Fertiges Haus: Das fertiggestellte Protein.
Avatar von

Ein anderes Problem?

Stell deine Frage

Willkommen bei der Helplounge! Stell deine Frage einfach und kostenlos

x
Made by a lovely community