0 Daumen
157 Aufrufe

Aufgabe:

Denke dir einen codogenen Strang für 20 Aminosäuren aus!

a) Sei er Teil eines Gens. Erkläre auch, was der codogene Strang ist.

b) Exprimiere ihn mit Hilfe der Codesonne.

Avatar von

1 Antwort

0 Daumen

Antwort mit KI erzeugt

Was ist der codogene Strang?

Der codogene Strang ist einer der beiden DNA-Stränge, die das genetische Material eines Organismus bilden. Er wird auch als nicht-Template-Strang bezeichnet und ist wichtig, weil die Sequenz der Basen auf diesem Strang der Sequenz der mRNA entspricht, die während der Transkription gebildet wird, aber mit Uracil (U) anstelle von Thymin (T). Das bedeutet, dass, wenn wir die Sequenz des codogenen Strangs haben, wir direkt die mRNA-Sequenz ableiten können, die dann bei der Translation in eine Aminosäuresequenz übersetzt wird. Der gegenüberliegende Strang wird als Template-Strang oder Matrizenstrang bezeichnet und wird von der RNA-Polymerase genutzt, um die mRNA zu synthetisieren.

Aufgabe a) Codogener Strang für 20 Aminosäuren

Zuerst denken wir uns eine DNA-Sequenz für den codogenen Strang aus, der für 20 Aminosäuren kodiert. Ein Codon, eine Sequenz von drei Basen (Nukleotiden) in der mRNA, kodiert für eine spezifische Aminosäure. Für 20 Aminosäuren benötigen wir also 60 Nukleotide.

Hier ist ein Beispiel eines codogenen Strangs (ohne spezifische Aminosäuren im Auge zu haben):

5' - ATGCGTACCGGTAACGTCAGGTCGACCCTTGAAGTTCGATCCTGACGTCAGT - 3'

Aufgabe b) Exprimiere ihn mit Hilfe der Codesonne

Die Codesonne ist ein Hilfsmittel, um zu bestimmen, welche Aminosäure von einem gegebenen Codon kodiert wird. Um unsere DNA-Sequenz zu exprimieren, müssen wir sie zuerst in eine RNA-Sequenz umschreiben, indem wir alle Ts (Thymin) durch Us (Uracil) ersetzen. Unser codogener Strang erzeugt folgende mRNA-Sequenz:

5' - AUGCGUACCGGUAACGUCAGGUCGACCCUUGAAGUUCGAUCCUGACGUCAGU - 3'

Jetzt benutzen wir die Codesonne, um jede Gruppe von drei Nukleotiden (jedes Codon) in eine Aminosäure zu übersetzen. Hier ein allgemeines Beispiel, wie man es macht (ohne die Sequenz spezifisch durch die Codesonne zu laufen, da die tatsächlichen Aminosäuren von der spezifischen Codesonne-Version abhängen):

- AUG codiert für Methionin (Met), und ist auch das Startcodon.
- CGU codiert für Arginin (Arg), usw.

Gehen Sie jedes Codon durch und übersetzen Sie es in die entsprechende Aminosäure, um die Sequenz der 20 Aminosäuren zu erhalten. Leider, ohne eine spezifische Codesonne vor mir zu haben, kann ich die spezifische Übersetzung von dieser RNA-Sequenz nicht präsentieren, aber du kannst jeden Satz von drei Buchstaben (jedes Codon) in der mRNA-Sequenz nehmen und ihn mit der Codesonne in die entsprechende Aminosäure übersetzen. Dies würde Ihnen die Sequenz der 20 Aminosäuren geben, die von der oben genannten DNA-Sequenz kodiert werden.
Avatar von

Ein anderes Problem?

Stell deine Frage

Willkommen bei der Helplounge! Stell deine Frage einfach und kostenlos

x
Made by a lovely community